Guide to genetics: различия между версиями
imported>Erol509 (Created page with "{{Under construction}} ==The Department== Welcome to Genetics. This room has two DNA Scanners and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later. A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all...") |
imported>Erol509 м (→Cloning) |
||
| Строка 653: | Строка 653: | ||
Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly. | Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly. | ||
== The Gene Genie - The Traitorous Geneticist == | == The Gene Genie - The Traitorous Geneticist == | ||
Версия от 15:12, 11 января 2023
|
Работа над страницей!
Данная страница в процессе создания или терпит глобальные изменения. |
The Department
Welcome to Genetics.
This room has two DNA Scanners and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later.
A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it.
DNA Modification
This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the Research Director .
Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms:
Unique Enzymes
- Unique Enzymes (UE) = Your name. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name.
Unique Identifiers
- Unique Identifiers (UI) = Your cosmetic details - eye color, skin color, hair style, hair color and gender.
In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people.
- Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore).
- Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between Enzymes (UE), Identity (UI) and Full Makeup (UE+UI).
- Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty.
- Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation injectors however, these DNA injectors are not permanent, and will only last for a short while after injected.
Structural Enzymes
- Structural Enzymes (SE) / Genetic Sequence = Your mutations. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere.
Genetic Sequencer
This is what the Sequencer tab may look like with a human in the scanner. In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are four types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. A goes with T, and G goes with C. Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the monkified mutation unless humanized. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles.
You might want to disable the monkey mutation by replacing one of the healthy pairs with annother letter. How to do all this will be detailed in the guide below.
Genetic Sequence Scanner
What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G. The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39. What it looks like after correctly filling all pairs. Mutation 39 turned out to be monkified. Since solving a mutation activates it, the subject in the scanner is now a monkey.
You can use your Genetic Sequence Scanner on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.
More info about some of the other tabs can be found in the guide further below.
List of Mutations
Before we start splicing, you must know what possible monstrosities can be done to a human. Normally unobtainable mutations are highlighted in red text.
| Mutation Name | Description | Indicators | Message | How/Where to Obtain | Instability |
|---|---|---|---|---|---|
| Telekinesis | "A strange mutation that allows the holder to interact with objects through thought."
This power allows the subject to control things with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. You can also use any console from a distance. |
Appears as a blue glow around the subject's head. | "You feel smarter" | Genetic / Punished God sect | 30 |
| Hulk | "A poorly understood genome that causes the holder's muscles to expand, inhibit speech and gives the person a bad skin condition."
Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. The subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery deals heavy brute damage to your arm. This mutation is lost when the subject falls to critical health.
|
Subject turns green and has red eyes. | "Your muscles hurt." | Radioactive + Strength | 40 |
| Temperature Adaptation | "A strange mutation that renders the host immune to damage from extreme temperatures, both hot and cold. Does not protect from vacuums [or areas of high pressure]."
This mutation is mutually exclusive with Pressure Adaptation. |
Subject has a pulsating orange "aura". | "Your body feels warm." | Genetic | 25 |
| Pressure Adaptation | "A strange mutation that renders the host immune to damage from both low and high pressure environments. Does not protect from temperature, including the cold of space [or super hot gas]."
This mutation is mutually exclusive with Temperature Adaptation. |
Subject has a pulsating blue "aura". | "Your body feels numb." | Genetic | 25 |
| Thermal Vision | "The user of this genome can visually perceive the unique human thermal signature."
Subject can see people even through walls and in darkness. Deals 10 eye damage on use, and lasts 10 (seconds?). |
\ | "You can see the heat rising off of your skin..." | Genetic | 25 |
| Chameleon | The subject becomes able to subtly alter light patterns to become invisible, as long as they remain still. | Subject starts fading into the background. | "You feel one with your surroundings." | Genetic | 25 |
| Dwarfism | Turns the subject into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping.
Mutually exclusive with Gigantism |
Subject looks smaller. | "Everything around you seems to grow.." | Human Species | 5 |
| Near Sightness | "The holder of this mutation has poor eyesight."
Makes the subject's screen go hazy at about halfway from the edge of your whole vision. It's not THAT bad, and can be temporarily fixed by using prescription glasses. |
\ | "You can't see very well." | Genetic | |
| Epilepsy | Subject starts to fall down and keeps shaking all the time. | Subject suffers from seizures. | "You get a headache." | Genetic | |
| Coughing | Makes the subject drop small items they're holding, like syringes. Pretty harmless, but has potential to be extremely annoying. | Subject coughs. | "You start coughing." | Genetic | |
| Tourette's Syndrome | The subject swears all the time. They may also experience paralysis that takes even longer than the seizures. Avoid. | Subject curses out loudly and twitches. | "You twitch." | Genetic | |
| Nervousness | Makes the subject stammer. Annoying at best. | Subject stammers when they speak. | "You feel nervous." | Genetic | |
| Blindness | Subject goes completely blind, becoming a part of a usually forgotten minority. How sad. | Subject's eyes don't react to penlight. | "You can't seem to see anything." | Genetic | |
| Deafness | Makes the subject deaf. Harmless at best, annoying at worst. You just don't hear anything, not even yourself. | \ | "You can't seem to hear anything..." | Genetic | |
| Illiterate | Subject becomes illiterate that stops them from using paper, pens, computers, and some electronics that require reading. | \ | "You feel unable to read or write." | Genetic | |
| Clumsiness | Inhibits certain brain functions, inducing clown-like clumsiness in subject. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, unable to use tasers, handcuffs, guns exploding in their face etc. | \ | "You feel lightheaded." | Genetic/Clowns | |
| Unintelligible | Heavily corrupts the part of the brain responsible for forming spoken sentences, causing the subject to only be able to speak short sentences. | \ | "You can't seem to form any coherent thoughts!" | Genetic | |
| Mute | Completely shuts down the speech center of the subject's brain. | \ | "You feel unable to express yourself at all." | Genetic / Punished God sect | |
| Wacky | Forces the subject to talk in an odd manner. | \ | "You feel an off sensation in your voicebox." | Genetic | |
| Glowy | Gives the subject a faint glow of random color.
Mutually exclusive with Anti-Glow |
Subject glows. | "Your skin begins to glow softly." | Genetic | 5 |
| Anti-Glow | Makes the subject absorb light in a radius around it.
Mutually exclusive with Glow; works for Ethereals and Luminescents |
Subject has an aura of darkness. Emit a ring of white light in light-emitting races. | "Your skin seems to attract and absorb nearby light creating 'darkness' around you." | Glowy + Void Magnet | 5 |
| Strength | "The user's muscles slightly expand."
Subject feels stronger, but isn't. Combine with Radioactive to make the Hulk power. |
\ | "You feel stronger" | Genetic | |
| Fiery Sweat | Subject "sweats liquid fire"[CITATION NEEDED] and randomly combust, but grows more resistant to fire. Tests determined it takes twice the amount of time for the subjects to completely burn (x0.5 modifier on BURN). Stability decreases the chances of combusting. | Subject will spontaneously combust | "You feel hot." | Genetic | |
| Void Magnet | "A rare genome that attracts odd forces not usually observed."
You have the power to make yourself mostly invincible for a brief period at the cost of being unable to move. You will also enter this state randomly and against your will, genetic stability reduces how often it happens. |
Subject is periodically replaced with a hole in reality shaped like the subject. | "You feel a heavy, dull force just beyond the walls watching you." | Genetic | 30 |
| Radioactive | "A volatile mutation that causes the host to sent out deadly beta radiation. This affects both the hosts and their surroundings."
One of the few radiation sources after the Radiation Modernization changes. |
Subject glows with a green aura | "You feel it in your bones" | Genetic | 5 |
| Telepathy | A mutation that allows the user to telepathically communicate to others. | Subject is able to broadcast its thought directly to others. | "You hear your thoughts echo in your mind" | Genetic / Punished God sect | 10 |
| Fire Breath | An ancient mutation that gives lizards breath of fire.
Enables the user to fire explosive fireballs, hotter the less it travels. |
Subject becomes able to breathe concentrated balls of fire. | "You feel a heat built up in your throat" | Lizard Species | 30 |
| Chav | Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. | \ | "Ye feel like a reet prat like, innit?" | Genetic | |
| Swedish | "A horrible mutation originating from the distant past. Thought to be eradicated after the incident in 2037."
Forces the language center of the subject's brain to construct sentences in a vaguely norse manner. |
\ | "You feel Swedish, however that works." | Genetic | |
| Medieval | "A horrible mutation originating from the distant past, thought to have once been a common gene in all of old world Europe."
Forces the language center and primary motor cortex of the subject's brain to talk and act like a knight on a quest for the Holy Grail. |
\ | "You feel like seeking the holy grail!." | Genetic | |
| Pig Latin | "Historians say back in the 2020's humanity spoke entirely in this mystical language."
Increase the level of skillchip' complexity the subject can handle. |
\ | "Omethingsay eelsfay offyay." | Genetic | 5 |
| Insulated | This makes you shock resistant, not unlike wearing a pair of insulated gloves, without the downsides. | The subject does not conduct electricity. | "Your fingertips go numb." | Genetic | 25 |
| Shock Touch | "The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others."
This gives you a non-antag Mansus Grasp shocking people, which will do burn damage and large amounts of jittering and confusion. Does not protect the subject against shocks. |
Subject can electrocute other people with their bare hands. | "You feel power flow through your hands." | Insulated + Radioactive | 30 |
| Transcendent Olfaction | "Your sense of smell is comparable to that of a canine."
This power lets you track people by scent. Hold something in your hand and use the power to look for a scent on it. Use the power without holding anything and you'll track the scent you previously found. |
\ | "Smells begin to make more sense..." | Genetic | 30 |
| Geladikinesis | Allows the user to concentrate moisture and sub-zero forces into snow | This mutation lets you create snow, used to build snowtiles, walls, balls and snowmen | "Your hand feels cold" | Genetic | 10 |
| Cryokinesis | Draws negative energy from the sub-zero void to shoot freezing beams | Lets the user shoot a bolt of cryokinesis to freeze people, objects and tiles | "Your hand feels cold" | Genetic | 20 |
| Antenna | The affected person sprouts an antenna. This is known to allow them to access common radio channels passively. | An antenna is visible on the user's head, and they basically have a built in station-bounced radio. | "You feel an antenna sprout from your forehead." | Genetic | 5 |
| Mind Reader | The affected person can look into the recent memories of others.
They can read the minds of others. This will reveal the name of the target and some snippets of what the target has said in the past. Tin foil is known to block this power. |
An antenna is visible on the user's head, and the read-ee may feel something strange enter their mind. | "You hear distant voices at the corners of your mind." | Antenna + Paranoia / Punished God sect | 40 |
| Spatial Instability | The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea. | Subject randomly teleports a short distance away and has a tendency to increase the janitor's workload. | "The space around you twists sickeningly." | Genetic | 10 |
| Paranoia | "Subject is easily terrified, and may suffer from hallucinations." | Subject screams frequently | "You feel screams echo through your mind..." | Genetic | |
| Gigantism | The cells within the subject spread out to cover more area, making them appear larger.
Subjects show increased tackling abilities, both offensive and defensive. Mutually exclusive with Dwarfism |
Subject is slightly larger than normal | "Everything around you seems to shrink.." | Genetic | |
| Two Left Feet | "A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step." | Subject is randomly knocked down. | "Your right foot feels... left." | Genetic | |
| Autonomy | Allows a creature to voluntarily discard a random limb, to help it escape from predators. | \ | "Your joints feel loose." | Genetic | 30 |
| Tongue Spike | Allows a creature to voluntary shoot their tongue out as a deadly weapon.
The tongue does not grow back, and remains embedded in the target until removed. |
Subject can shoot his tongue. | "Your feel like you can throw your voice." | Genetic | 15 |
| Stimmed | The user's chemical balance is more robust. (Does nothing.) | \ | "You feel stimmed." | Genetic | |
| Chem Spike | Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals.
The tongue does not grow back, and remains embedded in the target until removed. As long as it is embedded, it allows you to transfer the chemical in your body into the target's, one single time. Much less harmful than Tongue Spike on its own. |
Subject can shoot his tongue, and inject you with chemicals. | "Your feel like you can really connect with people by throwing your voice." | Tongue Spike + Stimmed | 15 |
| Webbing Production | Allows the user to lay webbing, and travel through it.
Subject may grow psychologically attached to laying webs if used enough. |
Subject lays webbing, or can move through some without being slowed down. | "Your skin feels webby." | Genetic | 15 |
| Internal Martyrdom | "A mutation that makes the body destruct when near death. Not damaging to others, but very, VERY disorienting."
Harmful to witnesses' eyes. Paralyze silicons as well. |
Subject explodes in a bloody shower when in deep crit. | "You get an intense feeling of heartburn." | Strong + Stimmed | |
| H.A.R.S. | A mutation that makes the body reject the head. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate head organs. | Subject loses their head, including eyes, ears, tongue etc. | "Something feels off." | Genetic | |
| Acidic Flesh | "Subject has acidic chemicals building up underneath the skin. This is often lethal."
Those buildups end up as acidic cutaneous eruptions, burning the subject. Acid-resistant clothes have been shown to protect the subject from those. |
The subject's skin frequently bubbles and pops, burning the subject. | "A horrible burning sensation envelops you as your flesh turns to acid." | Genetic | |
| Spastic | "Subject suffers from muscle spasms."
Subject may unintentionnally hit nearby people and machinery, and harm themselves. |
Subject frequently spasms. | "You flinch." | Genetic | |
| Monkified | "A strange genome, believing to be what differentiates monkeys from humans."
Transforms subject into a monkey. Innate mutation in humans and monkeys. |
Subject frequently spasms. | "You feel unusually monkey-like." | Genetic | |
| Autotomy | "Allows a creature to voluntary discard a random appendage." | Subject is able to discard its limbs without surgery. | "Your joints feel loose." | Genetic | 30 |
| Biotech Compatibility | "Subject is more compatibile with biotechnology such as skillchips."
Increase the level of skillchip' complexity the subject can handle. |
\ | No message | Genetic | 5 |
| Clever | "Causes the subject to feel just a little bit smarter. Most effective in specimens with low levels of intelligence."
Allows some mobs, such as monkeys, to perform advanced actions like surgery, use computers and PDAs, and more. |
\ | "You feel a little bit smarter." | Genetic | 20 |
| Stoner | "A common mutation that severely decreases intelligence."
Grants the Beach Bum language, revokes all the others. |
\ | "You feel...totally chill, man!" | Beach Bum respawn |
Chaplain Religion exclusives
Mutations granted by some of the Chaplain's religions. Their instability is set at 0.
"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."
| Name | Description | Message |
|---|---|---|
| Honorbound | "The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."
Disallows the subject to attack people unless they are attacked first. |
"You feel honorbound!" |
| Burdened | "The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."
Grants Telepathy and Mute, then Telekinesis and Mind Reader as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...). |
"You feel burdened!" |
Admin-spawn only mutations
| Name | Description | Indicators | Message | Instability |
|---|---|---|---|---|
| X-Ray Vision | "A strange genome that allows the user to see between the spaces of walls."
Basically it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination. Essentially replaced by the X-Ray implant. |
Subject's eyes "glow eerily" if looked at with a penlight. | "The walls suddenly disappear." | 35 |
| Laser Eyes | "Reflects concentrated light back from the eyes."
Enables to shoot laser beams (dmg 20). |
[to confirm] Subject's eyes glow | "You feel pressure building up behind your eyes." | |
| Elvis | Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. | A terrifying mutation named after its 'patient-zero'. | "You feel pretty good, honeydoll." | |
| Unstable DNA | Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one. | Strange mutation that causes the holder to randomly mutate. | "You feel strange." |
Guide to finding and using mutations
This guide here shows you step by step how to find the powers from the mysterious blocks!
First Steps
This guide will start with using a monkey, because they're in the pen for a reason.
- Start by taking a monkey from the pen.
- Shove it into a DNA Scanner next to the pen, by click dragging.
- Check the console next to it, you'll see a bunch of options. Find Genetic Sequencer.
All mutations are randomized every round.
Humanizing a Monkey
Always humanize your monkey first, or their powers wont work or be savable.
- You and your geneticist buddy automatically share the mutations you've discovered, so work togheter to discover them all.
- Click through the mutations and find Monkified. Then break a random pair by changing a letter to X.
- When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
- If for any reason you got yourself some bad mutations and have no one to remove them, grab the mutadone pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of mutadone into it and take a sip. It should instantly clear all your mutations.
- Mutadone will also clear the monkified mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved mutadone into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.
Manifesting Mutations
Back to business! Now we'll try to make a mutation show itself to us:
- Find a mutation that has broken pairs.
- Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T.
- The left click increments from A to G (A>T>C>G>A) — the right click, the other way around.
- You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
- If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described above) by scanning the other monkeys, yourself, or random crewmembers, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—20 minutes on unupgraded scanners).
- If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or scramble their DNA.
Scramble DNA
Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has.
Activators and Mutators
After manifesting a mutation in the Genetic Sequencer tab, hit store to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab.
- Activators: An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a Genetic Sequence Scanner
. For example, since all humans have the monkified mutation dormant in them, a monkified activator will always work on humans. Using an activator will not increase genetic instability. Used activators can be recycled into the DNA scanner access console to produce chromosomes. - Mutators: A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's instability (causes death if it reaches 100%). The mutation and its instability may then be removed by taking Mutadone.
The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. The activator has a much shorter cooldown.
Advanced Injectors
After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following:
- Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
- Go to the Sequencer tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
- Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
- Go back to the "Adv. Injectors". Click Print. You will print an injector with named "Advanced (name) injector".
Genetic Instability
When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to 99 genetic instability before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.
Chromosome 21
Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console.
Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the Sequencer tab. Then click an activated mutation, or find one if none is active yet. You should see the line Select a chromosome followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back.
After you have added a chromosome to a mutation, you can store it to the Storage - mutations tab as normal (by clicking Save to console in the Sequencer tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome.
These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):
- Synchronizer (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%.
- Stabilizer (1/16): The rarest chromosome. Reduces instability gained from the mutation by 20%.
- Power (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
- Energetic (5/16): Reduces cooldown on action based mutations.
Reinforcement (3/19): Makes the mutation immune to mutadone.Removed Aug 2020.
Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.
What to do with your powers
- Export your best powers to a disk, as a backup. There's always the risk of an AI or someone else deleting them for any reason.
- Make injectors to give to
the greytidethe heads of staff, the security, or the Engineers. You can also sell them for money! - Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
- Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.
Healing your subjects and yourself
During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably H.A.R.S. and Radioactive. If unlucky, you may also be hurt. For that, there are several solutions:
- The Roboticist can build medibots. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively.
- The Chemists can provide you specific medicines, including Potassium Iodide for radiations (and toxins in irradiated carbons), Pentetic Acid for toxins and rads, and several others for burns, brute, or whatever else you may need.
Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found.
CRISPR Editing
This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from instability
Getting a CRISPR Charge
First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.
- Get the Viro to make a virus with either Dormant DNA Activator or Viral Evolutionary Acceleration (Ideally otherwise benign)
- Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
- Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
- Feed the used activator to the console to add the charge to the console
Using a CRISPR Charge
You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:
- Solve the mutation you want or just use a mutator on a humanized monkey
- Take note of the top row
- On the subject you want to swap mutations on, solve the mutation you want to swap
- Use a CRISPR charge on it
- Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
Building the CRISPR String
For example, let's say Epilepsy is
A T T A C G C G A T T A C G C GT A A T G C G C T A A T G C G C
And Telekinesis is
A T A T C C G G A T T A C C G GT A T A G G C C T A A T G G C C
Take note of the first row of both
- Epilepsy is
A T T A C G C G A T T A C G C G - Telekinesis is
A T A T C C G G A T T A C C G G
You then need to weave these rows together, old-new-old-new-old-new like this:
_A T A T C C G G A T T A C C G G :NEW (Telekinesis)AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR StringA T T A C G C G A T T A C G C G_ :OLD (Epilepsy)
Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps Epilepsy out for Telekinesis.
AATTTAATCCGCCGGGAATTTTAACCGCCGGG
If your string is not the right length, nothing happens, but if the string is wrong, you may end up with Acid Flesh instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.
Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.
The Gene Genie - The Traitorous Geneticist
Sorry for the bad chapter title. I wanted to use that for a very long time.
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.
Revolutionary
If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.
Traitor
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.
If you have to kill someone, same stuff from rev.
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.
Changeling
You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect.
Returning to Monke
If you're looking for combat or stealth bonuses, you may use Monkified to get the monkeys', as well as several useful mutations (e.g., Telekinesis, Shock Touch, Chameleon, Gigantism and Dwarfism). Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the Xenobiologist's slime transformation).
Alternatively, there are gorillas. Since the radiation modernization changes (Oct, 2021), you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists.
Given their status as a simplemob, gorillas are immune to wounds and most chemicals—essentially the Hulk's weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls.
- Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas.
The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit).
To transform a monkey into a gorilla, you have two options:
- Genetic bombing: once above 2500 genetic damage, monkeys have a 25% chance per second to transform.
- Mind-Magnification Helmets: when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla.
Additionally, the Traitor geneticist's uplink offers Gorilla Cubes and an autoinjector turning them into a gorilla.

